Usage without react
These libraries do not depend on any third party libraries. These are the most low level libraries in the @anocca/sequence-viewer-* suite.
Installation
# Pick one or both
npm i @anocca/sequence-viewer-render-circular
npm i @anocca/sequence-viewer-render-linear
# utils is recommended to get started
npm i @anocca/sequence-viewer-utils
-render-circular and -render-linear both export a function called drawCircular and drawLinear.
"Draw" refers to drawing the bitmap graphics on a HTML5 canvas element.
Usage
- Example
- Result
import { drawCircular } from '@anocca/sequence-viewer-render-circular';
/* or for linear */
// import { drawLinear } from '@anocca/sequence-viewer-render-linear';
import { getRatio, humanCodons, scaleBuffer } from '@anocca/sequence-viewer-utils';
const w = 640;
const h = 480;
const buffer = document.getElementById('canvas');
scaleBuffer(buffer, w, h);
const c = buffer.getContext('2d')
const { ratio } = getRatio(c);
drawCircular({
c,
w,
h,
ratio,
data: {
mouseX: 0,
mouseY: 0,
circluarCamera: {
angleOffset: 0,
scrollOffsetZoomed: 0,
scrollOffsetZooming: 0,
value: {
zoom: 1,
angle: 1,
radius: 1,
},
target: {
zoom: 1,
angle: 1,
radius: 1
}
},
matrix: {
a: 1,
b: 0,
c: 0,
d: 1,
e: 0,
f: 0
}
},
isProtein: false,
sequence: 'TCCTCGCATAGGGCGGATCGGTATTCAT',
circularSelection: [],
searchResults: [],
annotationLevels: [],
renderStateRef: {
hoveringFeature: undefined,
clickedFeatures: []
},
codons: humanCodons
});
/* in html */
<canvas id="canvas"></canvas>
This just renderes the canvas statically without any DOM bindings and thus no out of the box support for zoom, drag and scroll